Dna-sequenzierung

Logo

Genetische Sequenzierung von Lebensmitteln

"The Open Food Repo DNA" ist eine Zusammenarbeit zwischen mehreren Partnern mit dem Ziel, die DNA-Komponente von Lebensmitteln in das Projekt “The Open Food Repo” aufzunehmen. Die Idee ist, einfache und erschwingliche Protokolle (wie ein Rezept) für die genetische Sequenzierung von verarbeiteten Lebensmitteln zu entwickeln, mit dem langfristigen Ziel, dass jeder seine Lebensmittel zu Hause testen und die Inhaltsstoffe tierischen oder pflanzlichen Ursprungs identifizieren kann. Links zum Herunterladen der DNA-Sequenzen werden auf unserer Website zugänglich sein.

Warum die DNA von Lebensmitteln sequenzieren?

Unser gegenwärtiges Nahrungsmittelsystem ist eine mehrstufige und komplexe Kette, die viele Unternehmen einbeziehen kann, oft über Landesgrenzen hinweg. In jeder Phase des Prozesses kann ein Produkt absichtlich (zur Verbesserung der Haltbarkeit, zur Verwendung billigerer Zutaten, zur Verbesserung des Geschmacks usw.) oder durch unbeabsichtigte Kontamination verändert werden - ohne dass die nächsten Unternehmen, Einzelhändler oder Verbraucher in der gesamten Kette davon Kenntnis haben. Häufige "Lebensmittelbetrug"-Techniken beinhalten die Verwendung von künstlichen Aromen anstelle von teuren natürlichen Zutaten wie Vanille oder Trüffel, die Verdünnung mit einer billigeren Substanz, z.B. Milch mit Soja, oder die einfache Etikettierung eines Lebensmittels als etwas Teureres, z.B. Forelle als Lachs. Woher wissen wir das?

Logo

Genau wie der Mensch ist auch die DNA jeder Tierart und jeder Pflanze unterschiedlich und einzigartig. Das bedeutet, dass wir verschiedene Inhaltsstoffe anhand ihrer DNA identifizieren können.

Was ist DNA-Sequenzierung?

Die DNA besteht aus einer Sequenz von Aminosäuren, die als "Basen" bezeichnet werden. Es gibt vier verschiedene Basen: Thymin (T), Cytosin (C), Guanin (G) und Adenin (A). Diese werden durch die Buchstaben A, C, G und T dargestellt, die wie ein Geheimcode gelesen werden können. In den Zellen aller lebenden Organismen, von einem Gorilla bis zu einer Zwiebel, ist alle Information, die für die Entwicklung und Funktion eines Organismus notwendig sind, in diesem Code enthalten. Da es sich bei der DNA um einen Doppelstrang handelt, hat jede Base auf einem Strang ein Komplement auf dem gegenüberliegenden Strang (C-G, A-T). Wir bezeichnen diese als Basenpaare. Eine menschliche Zelle enthält eine Nachricht von etwa 3 Milliarden Basenpaaren Länge. Die DNA-Sequenzierung ist der Vorgang der Umwandlung des genetischen Materials in eine Sequenz der Form ATTTCGGGTTACTTGGGGAT, die dann analysiert und interpretiert werden kann.

Da die DNA-Sequenzierung in den letzten Jahren viel schneller, einfacher und billiger geworden ist, werden wir diese neuen Techniken nutzen, um ein einfaches Protokoll zu entwickeln, mit dem Menschen die DNA ihrer Nahrung "lesen" können. Dies wird es den Menschen ermöglichen, die Zutaten der Lebensmittel unabhängig von den Produzenten zu sehen.

Die gesamte DNA-Sequenz ist eine große Menge an Information, und es ist nicht nötig, alles zu kennen, um eine Spezies zu identifizieren - deshalb verwenden wir eine Technik namens DNA-Barcodierung.

Was ist DNA-Barcodierung?

Wir betrachten ein sehr kleines Stück DNA, das bei allen Arten ähnlich genug ist, um es aus dem Rest der DNA herauszuschneiden, aber doch für unterschiedliche Arten genug unterschiedlich und einzigartig, sodass wir vermögen, es zu differenzieren - somit verhält es sich effektiv wie ein Barcode. Da nun diese Sequenz nur einige hundert Basenpaare umfasst, verbraucht sie weniger Ressourcen, als wenn wir alle 3 Milliarden Basenpaare sequenzieren müssten.

Mit den richtigen Werkzeugen können wir diese DNA, die zeigen soll, ob die auf dem Etikett aufgeführten Inhaltsstoffe tatsächlich enthalten sind (und nicht ein künstliches Aroma oder ein Ersatz) lesen. Wir können erkennen, ob sich etwas im Inneren befindet, das nicht auf dem Etikett steht und ob ein Allergen vorhanden ist oder nicht (wenn es heißt "kann Spuren von" enthalten). Die Technologie befindet sich jedoch noch in einem frühen Stadium und führt noch nicht zu zuverlässigen Ergebnissen.

Was ist neu oder innovativ an der vom Projekt "The Open Food Repo DNA" entwickelten Methode?

Derzeit ist die genetische Untersuchung von Lebensmitteln ein kostspieliges und umfangreiches Unterfangen, das in großen, gut ausgestatteten Labors entweder in privaten Unternehmen oder in staatlichen Einrichtungen wie Universitäten durchgeführt wird. Es ist ein Prozess, der für Menschen ohne große Infrastruktur oder Mittel nicht zugänglich ist. Bei verarbeiteten Lebensmitteln gibt es besondere Schwierigkeiten: Verschiedene Verarbeitungsstufen wie Sterilisation, Pasteurisation und das Beifügen von Zusatzstoffen schädigen die DNA und hindern die Reagenzien, mit denen die DNA (Enzyme) extrahiert und amplifiziert werden soll.

Unser Ziel ist es, eine Reihe von Instruktionen zur Verfügung zu stellen, die es ermöglichen, den Prozess mit begrenzten Ressourcen und Schulungen durchzuführen. Ein langfristiges Ziel ist es sogar, dass Sie es in Ihrer eigenen Küche tun können!

Wie funktioniert unser Prozess?

1) Das Essen wird gemischt.
2) Das genetische Material (DNA) wird extrahiert.
3) Das Stück DNA von Interesse wird "ausgeschnitten" und mehrfach kopiert.
4) Das Amplikon (die vielen Kopien) wird in eine Sequenziervorrichtung geladen, die die Moleküle in ein elektrisches Signal umwandelt, welches seinerseits in Basen übersetzt werden kann. Daraus ergibt sich eine lange Reihe von Buchstaben (DNA-Code), die mit Referenzsequenzen verglichen werden kann, um das Vorhandene zu identifizieren.
Logo

Implikationen:

In den nächsten Jahren wird sich diese Technologie so erweitern, dass jedes auf den Markt gebrachte Produkt voraussichtlich sequenziert werden kann. Zahlreiche Skandale und Berichte über Fehl-etikettierungen oder Betrug in der Lebensmittelindustrie haben den Markt erschüttert. Die Genetische Sequenzierung - hoffentlich gefolgt von Tests auf nicht lebende Produkte wie Pestizide - könnte eine neue Ära einleiten, um Vertrauen und Zuverlässigkeit wieder aufzubauen.

Da es sich um ein Citizen Science Projekt handelt, ist unser Ziel, dass auf lange Sicht jeder Verbraucher in der Lage sein wird, den Test durchzuführen - und wir alle werden mit mehr Informationen über die Lebensmittel, die wir kaufen, ausgestattet sein.

Wo werden die Informationen verfügbar sein?

Auf FoodRepo.org, der ersten offenen und kollaborativen Datenbank für barcodierte Lebensmittel in der Schweiz! Die Website wird derzeit neu gestaltet, um sich mehr auf die Online-Community zu konzentrieren. Die Datenbank enthält Informationen über Lebensmittel aus dem privaten/gewerblichen Bereich bis hin zum öffentlichen Bereich und ermöglicht es jedem Bürger, zu navigieren. Jeder, der eine App erstellen möchte, kann die über eine API (Link zu; https://www.foodrepo.org/api-docs/swaggers/v3) verfügbaren Daten nutzen. Es gibt derzeit über 40'000 Barcode-Produkte und sie wachsen täglich!

Partner


Logo Digital Epidemiology-Labor an der EPFL: Projektmanagement www.digitalepidemiologylab.org
Logo SwissDeCode: Entwicklung der Protokolle www.swissdecode.com
Logo Hackuarium: Durchführung von Citizen Science Workshops www.hackuarium.ch
Logo Jebsen-Stiftung: Finanzierung des Projekts zur Förderung von Innovationen im Bereich der Ernährung www.kgjf.org