Séquençage de l'adn

Logo

Séquençage génétique des aliments

"Open Food Repo DNA" est une collaboration entre plusieurs partenaires qui ajoutera la composante ADN des produits alimentaires à l'Open Food Repo. L'objectif est de développer des protocoles faciles et abordables (comme une recette) pour le séquençage génétique des aliments transformés dans le but à long terme que chacun puisse tester ses aliments à la maison et identifier les ingrédients d'origine animale ou végétale. Des liens pour télécharger les séquences d'ADN seront accessibles sur notre site Web.

Pourquoi séquencer l'ADN des aliments ?

Notre système alimentaire actuel est une chaîne complexe et en plusieurs étapes qui peut impliquer de nombreuses entreprises, souvent au-delà des frontières. A chaque étape du processus, un produit peut être modifié, soit intentionnellement (pour améliorer la durée de conservation, utiliser des ingrédients moins chers, améliorer le goût, etc.), soit par contamination accidentelle, sans que les prochaines entreprises, détaillants ou consommateurs de la chaîne en soient conscients. Les techniques courantes de " fraude alimentaire " comprennent l'utilisation d'arômes au lieu d'ingrédients naturels coûteux comme la vanille ou la truffe, la dilution avec une substance moins chère, par exemple du lait avec du soja, ou l'étiquetage d'un aliment comme étant un aliment à aspect similaire mais de plus haute valeur marchande, par exemple de la truite vendue comme saumon. Comment pouvons-nous savoir si nous sommes dans cette situation?

Tout comme les humains, l'ADN de chaque type d'animal et de chaque plante est différent. Cela signifie que nous pouvons identifier différents ingrédients en examinant leur ADN.

Logo

Qu'est-ce que le séquençage d'ADN ?

L'ADN est constitué d'une chaîne d'acides aminés, dits "bases". Il y a quatre bases différentes: Thymine (T), Cytosine (C), Guanine (G) et Adénine (A). Ces bases sont représentées par les lettres A, C, G et T, qui peuvent être lues un peu comme un code secret. Ce code, dans les cellules de tous les organismes vivants, du gorille à l'oignon, contient toutes les informations nécessaires au développement et au fonctionnement d'un organisme. Puisque l'ADN est un double brin, chaque base sur un brin correspond à une base sur le brin opposé (A-T et C-G). C'est ce que nous appelons les paires de bases. Une cellule humaine contient un message d'environ 3 milliards de paires de bases. Le séquençage de l'ADN est le fait de convertir le matériel génétique en une séquence telle que "ATTTCGGGTACTTTGGGGAT" qui pourrait ensuite être analysée et interprétée.

Comme le séquençage de l'ADN est devenu beaucoup plus rapide, plus facile et moins coûteux au cours des dernières années, nous utiliserons ces nouvelles techniques pour élaborer un protocole simple permettant aux gens de "lire" l'ADN de leurs aliments. Cela permettra de voir les ingrédients de l'aliment indépendamment des producteurs.

L'ensemble de la séquence d'ADN est une grande quantité d'information qui n’est pas toute nécessaire pour identifier des espèces, c'est pourquoi nous utilisons une technique appelée “DNA barcoding”: le code-barres ADN.

Qu'est-ce qu'un code-barres ADN ?

Nous examinons un très petit morceau d'ADN qui est assez semblable chez toutes les espèces pour qu'on puisse l'extraire du reste de l'ADN, mais assez différent entre les différentes espèces pour qu'on puisse les distinguer - il agit effectivement comme un code-barres. Comme il s'agit d'une séquence de quelques centaines de paires de bases, elle utilise moins de ressources que si nous séquencions les 3 milliards de paires de bases.

Avec les bons outils, nous pourrons lire cet ADN, qui devrait indiquer si les ingrédients énumérés sur l'étiquette sont effectivement contenus (plutôt qu'un arôme ou un substitut artificiel), s'il y a quelque chose à l'intérieur qui ne figure pas sur l'étiquette et si un allergène est présent ou non (quand il dit "peut contenir des traces"). Il n'en est qu'à ses débuts et ne donne pas encore de résultats fiables.

Qu'y a-t-il de nouveau ou d'innovant dans la méthode développée par le projet "The Open Food Repo DNA" ?

Actuellement, l'analyse génétique des aliments est une entreprise coûteuse et vaste qui se fait dans de grands laboratoires bien équipés, soit dans des entreprises privées, soit dans des institutions publiques comme les universités. C'est un processus qui n'est pas accessible aux personnes qui ne disposent pas d'une infrastructure ou de moyens importants. Il existe des difficultés spécifiques aux aliments transformés : les différentes étapes de la transformation telles que la stérilisation, la cuisson à haute température et les additifs endommagent l'ADN et rendent moins efficaces les ingrédients utilisés pour extraire et amplifier l'ADN (enzymes).

Notre objectif est de mettre à disposition un ensemble d'instructions qui permettraient de réaliser le processus avec des ressources et une formation limitées. Un objectif à long terme est même que vous puissiez le faire dans votre propre cuisine !

Comment fonctionne notre processus ?

1) La nourriture est mélangée.
2) Le matériel génétique (ADN) est extrait.
3) Le morceau d'ADN qui présente un intérêt est "découpé" et copié plusieurs fois.
4) Celui-ci est placé dans un dispositif de séquençage qui convertit les molécules en un signal électrique qui peut ensuite être traduit en bases. Cela produit une longue chaîne de lettres (code ADN) qui peut être comparée à des séquences de référence pour identifier ce qui est présent.

Logo

Implications :

Au cours des prochaines années, cela pourra signifier que tout produit mis sur le marché sera probablement séquencé. De nombreux scandales et des informations faisant état de fausses étiquettes ou de fraudes dans l'industrie alimentaire ont ébranlé le marché. Le séquençage génétique, suivi, idéalement, de tests pour les produits non vivants comme les pesticides, ouvre une nouvelle ère pour instaurer la confiance et la fiabilité.

Comme il s'agit d'un projet de science citoyenne, l'objectif est qu'à long terme, n'importe quel consommateur puisse faire le test - et nous serons tous en mesure d'obtenir plus d'informations sur les aliments que nous achetons.

A quel stade est le projet?

Nous venons de tester la première version du protocole! Le samedi 4 mai au laboratoire de communauté Hackuarium, un petit groupe de scientifiques et d'activistes pour la science ouverte et la transparence alimentaire ont passé la journée au labo pour tester et améliorer le protocole. Nous avons réussi à générer des données ADN! Elle seront disponibles bientôt. Cette journée qui s'est déroulée dans une ambiance très conviviale s'est terminée par un apéritif et nous a permis de recueillir beaucoup de suggestions pour la suite du projet et le prochain atelier. Si vous êtes intéressés à participer au prochain, écrivez à dna@foodrepo.org! En bas de cette page vous verrez des photos de l'atelier. Un article sur l'atelier a également été diffusé sur la page principale de l'EPFL, vous pouvez le trouver ici https://actu.epfl.ch/news/et-si-les-citoyens-pouvaient-analyser-l-adn-des-al/

Quel protocole a été utilisé?

Vous pouvez télécharger le protocole ici: https://d2v5oodgkvnw88.cloudfront.net/uploads_production/image/data/171512/workshop_protocol_final-updated.pdf

Où l'information sera-t-elle disponible ?

Sur FoodRepo, la première base de données ouverte et collaborative d'aliments en Suisse ! Cette base de données héberge des informations sur les aliments à code-barres en les faisant passer du domaine privé/commercial au domaine public et permet à chaque citoyen de naviguer. Quiconque souhaite créer une application peut utiliser les données disponibles via une API (www.foodrepo.org/api-docs/swaggers/v3). Il y a actuellement plus de 40'000 produits à code-barres et ce nombre augmente chaque jour ! Le site Web est actuellement en cours de refonte pour mettre l'accent sur la communauté en ligne. En attendant si vous voulez les données, vous pouvez les télécharger ici https://we.tl/t-iSWknUjbSp et contacter dna@foodrepo.org si vous avez un souci. AVERTISSEMENT: les protocoles sont encore en cours de development et à ce stade de ne pouvons pas garantir la qualité ou la précision des données ni de résultats d'analyses qui pourraient être faites sur ces données.

Partenaires


Logo Laboratoire d'épidémiologie numérique de l'EPFL : gestion de projet www.digitalepidemiologylab.org
Logo SwissDeCode : développement des protocoles www.swissdecode.com
Logo Hackuarium : accueil d'ateliers scientifiques citoyens www.hackuarium.ch/fr
Logo Fondation Jebsen : financement du projet de soutien à l'innovation dans le domaine de la nutrition www.kgjf.org

Gallerie

Veuillez demander permission pour l'utilisation des photos: dna@foodrepo.org Logo © Alain Herzog / 2019 EPFL

Logo © Alain Herzog / 2019 EPFL

Logo © Alain Herzog / 2019 EPFL

© Alain Herzog / 2019 EPFL

© Alain Herzog / 2019 EPFL

© Alain Herzog / 2019 EPFL

© Alain Herzog / 2019 EPFL

© Alain Herzog / 2019 EPFL

© Alain Herzog / 2019 EPFL

© Alain Herzog / 2019 EPFL

© Alain Herzog / 2019 EPFL

© Alain Herzog / 2019 EPFL

© Alain Herzog / 2019 EPFL

© Alain Herzog / 2019 EPFL

© Alain Herzog / 2019 EPFL

© Alain Herzog / 2019 EPFL

© Alain Herzog / 2019 EPFL

Talia Salzmann

Talia Salzmann

Talia Salzmann

Talia Salzmann

Talia Salzmann

Talia Salzmann

Talia Salzmann

Talia Salzmann

Talia Salzmann

Rachel Aronoff

Rachel Aronoff

Rachel Aronoff

Rachel Aronoff

Rachel Aronoff

Rachel Aronoff

Rachel Aronoff

Rachel Aronoff

Rachel Aronoff

Rachel Aronoff

Rachel Aronoff

Rachel Aronoff

Rachel Aronoff
Contrôle de qualité par gel après la première amplification

Rachel Aronoff
Contrôle de qualité par gel après la première amplification