Le premier atelier de séquençage

Le premier atelier de séquençage de l’ADN d’aliments a été un succès!

Grâce à une équipe dévouée de participants qui ont parcouru toutes les étapes du protocole avec rigueur et bonne humeur, nous avons obtenu l'ADN d'échantillons d'aliments complexes !

Il s'agissait d'une première dans un laboratoire de communauté. Nous avons donc montré qu’il est possible d'obtenir des séquences ADN à partir d'aliments en utilisant du matériel et des protocoles relativement simples et abordables.

Image atelier 1
© Alain Herzog / 2019 EPFL


© Alain Herzog / 2019 EPFL

Nous avons séquencé : pesto, viande hachée, bâtonnets de poisson, chips au paprika, germes d'oignon, salade de poulet, amandes moulues, mélange de céréales, yaourt, falafels, fromage à tartiner au raifort et un sandwich au thon.

8 des 12 échantillons ont fourni une quantité considérable de données. Vous pouvez télécharger les données ici https://we.tl/t-TwI6Tq7Lke (lien valable jusqu'au 3 juin 2019 à 16h)

Ceci est un exemple d'une des séquences :

CTAGCATCGCCCTTTGTAACGATCAAGACTGGTAAGTAAGT CCATCGGTCCATCATAGTTTTGTCCGGCCGGCGGCTGCTG CTGCTGCTTCCAGGTGGAACTGGAACTCCAGGTTGTTGAG TTACTCAGAATGCTGCCAATATCCAATCCAATGAGCAGTTTT AAGATTTAATGCTGCTTGCTGCTTGCTCCTTTAACACACCAC CCTTTTTGAATGAATTCAGCTCTCTCTGCTTA

D'après vous, de quel aliment provient cette séquence - chips au paprika, fromage à tartiner ou sandwich au thon ?

Astuce : vous pouvez copier-coller la séquence sur https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome

Réponse ci-dessous.

Les prochaines étapes sont les suivantes : trouver un moyen fiable d'analyser les milliers de séquences que cela produit, voir si nous pouvons clairement identifier les ingrédients et si tous les aliments présents apparaissent dans les données, ainsi que comprendre pourquoi certains échantillons (marqués d'un x) ont échoué. Peut-être que le mixeur n'était pas assez fort, ou que les additifs dans l'aliment inhibent les réactions chimiques....

Si vous avez des idées, n'hésitez pas à nous contacter via dna@foodrepo.org !

Vous pouvez découvrir les photos de l'événement ainsi que le protocole ici : www.foodrepo.org/dna. Si vous essayez les protocoles, vous pouvez nous écrire nous serions ravis de recevoir vos commentaires et/ou collaborer.

Vous pouvez lire l'article paru sur la page d'accueil de l'EPFL : https://actu.epfl.ch/news/et-si-les-citoyens-pouvaient-analyser-l-adn-des-al/

Réponse : c'est un capsicum (poivron/piment) provenant des chips au paprika https://fr.wikipedia.org/wiki/Capsicum_annuum

l'Article précédent

Open Food Hackdays 2018

22 janvier 2018

FoodRepo fera à nouveau partie des prochains Open Food Hackdays ...

Lire l'article