The first food DNA workshop
29 maggio 2019

The first food DNA workshop was a success

Thanks to our dedicated team of participants who went through all the steps of the protocol with rigour and good humour, we obtained DNA from complex food samples!

A first in a community setting, this was a proof-of-concept: it is possible to obtain DNA from food using relatively simple and affordable equipment and protocols.

Workshop Image 1
© Alain Herzog / 2019 EPFL


© Alain Herzog / 2019 EPFL

We sequenced: pesto, minced meat, fish fingers, paprika chips, onion sprouts, chicken salad, ground almonds, a mix of grains, yoghurt, falafels, horseradish cream cheese and a tuna sandwich.

8 of the 12 samples provided considerable amounts of data. You can download the data here https://we.tl/t-TwI6Tq7Lke (link valid until 3rd of June 2019 at 4pm)

This is an example of one of the sequences:

CTAGCATCGCCCTTTGTAACGATCAAGACTGG TAAGTCCATCGGTCCCATACAGTTGTCCGTAAT GCCAGTAGAAGATTCGGCGCTACCGCGGCCC TGCTTCTTCAGGTGGAACTCCAGGTTGAGTTAC TCAGAATGCTGCCAATATATCCAATGCCAGCAG TTTGGTACTCAAGAGTATAATAAGTCAATTTGCT CTTTAACACCAGCTTTGAAATCCAACACTCGCT TTAGTCTCTGTTTGGTGACATAC

Which of the following food samples do you think this sequence came from - paprika chips, cream cheese or tuna sandwich?

Tip: you can copy-paste it in to https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome

Answer below.

The next steps are: to find a reliable way to analyse the thousands of sequences this produces, to see if we can clearly identify ingredients and if all foods present show up in the data, as well as figure out why some samples (marked with x) failed. Maybe the blender wasn’t strong enough, or the additives in the food inhibited the chemical reactions…

If you have any ideas, do get in touch via dna@foodrepo.org !

You can check out photographs from the event as well as the protocol here: www.foodrepo.org/dna. If you try out the protocols, let us know - we’d love to hear feedback and/or collaborate.

Read the news article published on EPFL homepage: https://actu.epfl.ch/news/enabling-consumers-to-analyze-their-food-s-dna/

Answer: it is capsicum, from the paprika chips https://en.wikipedia.org/wiki/Capsicum_annuum

Food Repo expands to include DNA!
30 aprile 2019

Where technology meets food transparency: Food Repo expands to include DNA!

A simple, affordable and open lab protocol to sequence the DNA in food? Access to the DNA sequence of your lasagna? Coming soon! We’re working on it—with a team of biohackers, food specialists and consumer rights advocates.

Find out more: www.foodrepo.org/dna

Open Food Hackdays 2018
22 gennaio 2018

FoodRepo farà ancora una volta parte dei prossimi Open Food Hackdays all' EPFL, il 27 e 28 gennaio 2018. Per saperne di più

Open Food Hackdays 27/28 Gennaio 2018

OpenFood changes name to Food Repo
18 gennaio 2018

As visitors to our website may have noticed, we have changed our name from OpenFood to Food Repo. The name change reflects our plans to become more personalized, and to expand beyond Switzerland. Both would have been difficult with the OpenFood Name. However, as can be seen in the logo, we remain fully committed to the open data cause, and other than the name, nothing changes. We look forward to growing Food Repo even more in the coming months and years!

OpenFood Community
02 giugno 2017

Are you interested in helping OpenFood? Today, we a are launching the OpenFood Community! Our first priority is to get more complete weight information on the food products. We are looking forward to your engagement in the community!

La API V3 di OpenFood é stata rilasciata
04 maggio 2017

Di recente abbiamo rilasciato l'OpenFood API V3: una versione stabile che ci aspettiamo di sostenere a lungo.

V1 è stata concepita principalmente per uso interno, mentre V2 per uso pubblico. In virtù degli ottimi feedbacks ottenuti durante gli ultimi Open Food Hackdays, abbiamo subito capito che dovevamo ripensare il nostro approccio. Il risultato di questo processo è V3.

Vi invitiamo a provarla ottenendo un codice API e consultando la documentazione. Abbiamo anche creato una sezione con un certo numero di esempi, che estenderemo prossimamente. Infine invitiamo tutti gli sviluppatori ad iscriversi alla OpenFood Developer Newsletter per restare aggiornati sugli sviluppi più recenti.

Non vediamo l'ora di vedere ciò la comunità riuscirá a costruire usando la API V3!

Meet the OpenFood Developers
27 marzo 2017

We’d like to highlight an event at EPFL on April 6. We will hold the first “Meet the OpenFood Developers" event at EPFL in Lausanne on Thursday, April 6th (QIE room - E building, Innovation Park).

This event is for those of you interested in becoming more involved in bringing the benefits of OpenFood to your specific communities. Everyone from the OpenFood team will be present to discuss with you personally any issue you would like to talk about (from tech support to launching concrete new collaborations).

In order to attend the event, please register here (space is limited). We are excited to see what we all can build with OpenFood data, and hope to see you at EPFL soon!

Open Food Hackdays
27 gennaio 2017

OpenFood will be part of the upcoming Open Food Hackdays in Lausanne and Zurich next 10/11 February. Find out more here.

Open Food Hackdays 10/11 February 2017

Benvenuto
04 novembre 2016

Siamo entusiasti di lanciare oggi openfood.ch: un database liberamente accessibile, contenente informazioni su svariati prodotti alimentari forniti di codici a barre, venduti in Svizzera.

Esiste la necessità di una banca dati di questo tipo? Senza dubbio. Attualmente, non esiste un database sui prodotti alimentari svizzeri che sia veramente aperto, libero e sopratutto accessibile tramite una API. Quest'ultimo aspetto è particolarmente importante in quanto permette la creazione di un ecosistema di servizi relativi ai dati alimentari, che costituisce d’altra parte uno dei principali obiettivi di openfood.ch.

Quella che stiamo lanciando è solo la prima versione di openfood.ch. Non pretendiamo che i nostri dati siano completi, ma al tempo stesso, con oltre 14.000 prodotti presenti nel nostro database, possiamo affermare di aver iniziato col piede giusto. Confidiamo di far leva sull’aiuto degli utenti per la crescita e la manutenzione di una banca dati di alta qualità. A breve infatti, espanderemo notevolmente la funzionalità crowdsourcing del nostro sito.

Nonostante ciò, siamo consapevoli della molteplicità di fonti che forniscono dati liberamente accessibili, sui prodotti alimentari in Svizzera. Proprio all’interno di questo contesto, siamo entusiasti di essere un partner indipendente dei prossimi open food data hackdays, che avranno luogo il 10-11 febbraio 2017, contemporaneamente presso l'EPFL di Losanna e il ZHdK di Zurigo. Per la relativa registrazione e maggiori informazioni su questo evento, si prega di consultare il sito https://food.opendata.ch.

Questo è solo l'inizio di un lungo percorso. Da una parte vorremmo fornire più dati sui prodotti alimentari, rispetto a quelli attualmente presenti sulle etichette. Ad esempio, grazie ai costi sempre piú bassi dell’analisi del DNA, probabilmente saremo presto in grado di consentire agli utenti di caricare anche il sequenziamento genomico (DNA) dei prodotti alimentari (vedi ad esempio https://opensnp.org/ e http://www.swissdecode.com/ per un confronto con progetti simili).

D'altra parte, è chiaro che una buona parte del cibo consumato non é dotato di un codice a barre - si pensi per esempio ai ristoranti o alle mense universitarie. In questo caso, abbiamo bisogno di un altro approccio per raccogliere i contenuti nutrizionali degli alimenti, come ad esempio l’analisi di una foto. Il team openfood.ch sta lavorando duramente su questo problema e sarà presto in grado di aprire una seconda API basata non sui codici a barre, ma sulle immagini (API di riconoscimento delle immagini). Siate certi che realizzeremo anche quella!

Newsletter

Iscriviti alla nostra newsletter per ricevere le ultime notizie su The Open Food Repo.

Termini di servizio

Tutti i contenuti (esclusi computer software) messi a disposizione da FoodRepo sul web, applicazioni e servizi sono distribuiti con licenza Creative Commons Attribution 4.0 International License, a meno di ulteriori indicazioni. Si prega di notare che le immagini possono contenere dati protetti da copyright (come ad esempio il logo del marchio).

Questa licenza specifica che è possibile copiare e ridistribuire il materiale in ogni mezzo o formato, così come riaggregare, trasformare, o sviluppare il materiale per qualsiasi scopo, anche commerciale.

Se si utilizzano i dati presenti nel nostro database, si prega di attribuire correttamente i crediti a FoodRepo, fornendo un collegamento (web link) alla licenza e indicando l’eventuale presenza di modifiche. Si prega inoltre di non indicare o alludere ad un eventuale supporto dal parte di FoodRepo.

FoodRepo non garantisce l'attualità, la correttezza e la completezza delle informazioni e dei dati presenti sul sito e nel database.